1. A piece of DNA sequence is: String DNA = “ACGGGAGGACGGGAAAATTTACTAGC”; Please write one or two statements to generate a reverse complement strand of the DNA sequence and assign it to a String variable rev_com. You should use classes in the biojava package, no import declarations are needed. 2 Write a method that could be called to concatenate any number of DNA sequences passed in as arguments, and return the concatenated DNA sequence. Two examples of calling the method are shown below: String DNA1 = dna.concat_DNAs(“ATGC”, “CGTA”); String DNA2 = dna.concat_DNAs(“AAAA”, “TTTT”, “GGGG”, “CCCC”); 3. Below is the title line of a Blast sequence search hit, please use a method of the String class to extract the GenBank accession number and assign it to a variable called Acc_num. String title = >ref|NM_001081660.1| Rattus norvegicus crystallin, gamma B (mapped) (Crygb), mRNA; 4. Write a Java program that uses a loop to prompt a user to input a clone ID and a DNA sequence. Include an if statement to exit the loop if the user entered the word exit. After the user entered an ID and the sequence, save them in a file in a FASTA format (header line starts with a > and followed by the clone id, and the sequences are in the subsequent lines). When the user entered exit, print out all the entered sequences to the screen in a FASTA format. 5. Write a program to open a text file (java.txt), and count how many words are in the file. A word is considered character(s) flanked by spaces, and it is not necessary to strip off the punctuation characters. The file name should be given as an argument to the program. Print a message to the screen to indicate how many words the file contains. Also, print out a sorted list of unique words followed by the number of occurrences of each word in the text.
Looking for solution of this Assignment?
WHY CHOOSE US?
We deliver quality original papers |
Our experts write quality original papers using academic databases.We dont use AI in our work. We refund your money if AI is detected |
Free revisions |
We offer our clients multiple free revisions just to ensure you get what you want. |
Discounted prices |
All our prices are discounted which makes it affordable to you. Use code FIRST15 to get your discount |
100% originality |
We deliver papers that are written from scratch to deliver 100% originality. Our papers are free from plagiarism and NO similarity.We have ZERO TOLERANCE TO USE OF AI |
On-time delivery |
We will deliver your paper on time even on short notice or short deadline, overnight essay or even an urgent essay |